ID: 907820037_907820041

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 907820037 907820041
Species Human (GRCh38) Human (GRCh38)
Location 1:57958272-57958294 1:57958310-57958332
Sequence CCAGCCTGATGTGCTTTTTAAAA CTGTGATACACTGGGTAAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 130, 4: 836} {0: 1, 1: 0, 2: 0, 3: 7, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!