ID: 907825912_907825914

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 907825912 907825914
Species Human (GRCh38) Human (GRCh38)
Location 1:58016741-58016763 1:58016758-58016780
Sequence CCATTCTCCATCTGTAATAAGCT TAAGCTATGTACTATGTACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 219} {0: 1, 1: 0, 2: 0, 3: 11, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!