ID: 907825912_907825915

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 907825912 907825915
Species Human (GRCh38) Human (GRCh38)
Location 1:58016741-58016763 1:58016765-58016787
Sequence CCATTCTCCATCTGTAATAAGCT TGTACTATGTACCAGGTGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 219} {0: 1, 1: 0, 2: 5, 3: 26, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!