ID: 907829489_907829491

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 907829489 907829491
Species Human (GRCh38) Human (GRCh38)
Location 1:58050906-58050928 1:58050942-58050964
Sequence CCATAATTCATTCACCAAATATT TACATGCTACATGTTGTTCTAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 55, 3: 248, 4: 909} {0: 1, 1: 0, 2: 1, 3: 28, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!