ID: 907840505_907840508

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 907840505 907840508
Species Human (GRCh38) Human (GRCh38)
Location 1:58152515-58152537 1:58152545-58152567
Sequence CCTTAGGAACATGCATGCAAATC CTCAGTCTTCTCTGCAAAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 180} {0: 1, 1: 0, 2: 15, 3: 64, 4: 403}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!