ID: 907849967_907849978

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 907849967 907849978
Species Human (GRCh38) Human (GRCh38)
Location 1:58247117-58247139 1:58247151-58247173
Sequence CCAGGAGATGAGCTGGGAGGCTC CAGAATGGGGGCAAGGAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 47, 4: 398} {0: 1, 1: 0, 2: 4, 3: 40, 4: 607}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!