ID: 907856997_907857005

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 907856997 907857005
Species Human (GRCh38) Human (GRCh38)
Location 1:58313374-58313396 1:58313417-58313439
Sequence CCCATGACAGGGACACAGACCTG CCCACAATGGCCTAAAGGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 229} {0: 1, 1: 0, 2: 3, 3: 8, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!