ID: 907893901_907893906

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 907893901 907893906
Species Human (GRCh38) Human (GRCh38)
Location 1:58665523-58665545 1:58665560-58665582
Sequence CCTCACTTATAACCAGGCAGGTA TAAGGGATTATTTCGATTATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 96} {0: 1, 1: 0, 2: 0, 3: 10, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!