ID: 907895663_907895674

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 907895663 907895674
Species Human (GRCh38) Human (GRCh38)
Location 1:58687797-58687819 1:58687842-58687864
Sequence CCAGACCTCTTCTGCCGATACCT CAGCAGCGGGCTCTGGCATTAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 8, 3: 19, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!