ID: 907920034_907920047

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 907920034 907920047
Species Human (GRCh38) Human (GRCh38)
Location 1:58903723-58903745 1:58903746-58903768
Sequence CCGCCCATGGGCCTCGGCAGTGC CCGCGGGAGGAGCGGGTGGAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!