ID: 907928367_907928379

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 907928367 907928379
Species Human (GRCh38) Human (GRCh38)
Location 1:58975699-58975721 1:58975734-58975756
Sequence CCCCACCTCCTGATACCATTACC TTTAACACATGGATTTTGGAGGG
Strand - +
Off-target summary {0: 4, 1: 30, 2: 220, 3: 762, 4: 1915} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!