ID: 907928369_907928377

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 907928369 907928377
Species Human (GRCh38) Human (GRCh38)
Location 1:58975701-58975723 1:58975730-58975752
Sequence CCACCTCCTGATACCATTACCTT AGGTTTTAACACATGGATTTTGG
Strand - +
Off-target summary {0: 3, 1: 25, 2: 222, 3: 785, 4: 1915} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!