ID: 907988486_907988493

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 907988486 907988493
Species Human (GRCh38) Human (GRCh38)
Location 1:59556046-59556068 1:59556077-59556099
Sequence CCCTTTTGTAAGGCTCAGCTGTC GAGAGATCTGCAGAGGCCTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 33, 4: 438}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!