ID: 907989537_907989545

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 907989537 907989545
Species Human (GRCh38) Human (GRCh38)
Location 1:59565929-59565951 1:59565961-59565983
Sequence CCCTATTTAATCTTCCCCTGTTC CTGTGGTCAAGTACCAAATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 266} {0: 1, 1: 0, 2: 0, 3: 8, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!