ID: 908035257_908035262

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 908035257 908035262
Species Human (GRCh38) Human (GRCh38)
Location 1:60044627-60044649 1:60044658-60044680
Sequence CCAGCTGCAGGCTGGGCTTCAGA TTGCTGATTTAAGTCACCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 367} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!