ID: 908072598_908072600

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 908072598 908072600
Species Human (GRCh38) Human (GRCh38)
Location 1:60478984-60479006 1:60479012-60479034
Sequence CCAAAGTTCTGGATTACAAGCAT ACCGCACCCAACCATAGATAAGG
Strand - +
Off-target summary {0: 1, 1: 36, 2: 567, 3: 1414, 4: 1985} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!