ID: 908128736_908128742

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 908128736 908128742
Species Human (GRCh38) Human (GRCh38)
Location 1:61053978-61054000 1:61054015-61054037
Sequence CCGAGCCAGAGGGCGGCGCCCGG AGCCGCCTCCTGCAGCCTCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 156} {0: 1, 1: 0, 2: 3, 3: 24, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!