ID: 908133671_908133672

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 908133671 908133672
Species Human (GRCh38) Human (GRCh38)
Location 1:61103956-61103978 1:61103982-61104004
Sequence CCTGGTCTTGACTTTTATTTGAG TTTATCTAGAAAAGATGATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 246} {0: 1, 1: 0, 2: 2, 3: 36, 4: 479}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!