ID: 908139224_908139230

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 908139224 908139230
Species Human (GRCh38) Human (GRCh38)
Location 1:61166396-61166418 1:61166437-61166459
Sequence CCCAGCTCCGTCTGTGTTCCATA ATCAGAAGATCCACCCACACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 67, 4: 1589}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!