ID: 908198993_908198996

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 908198993 908198996
Species Human (GRCh38) Human (GRCh38)
Location 1:61774534-61774556 1:61774563-61774585
Sequence CCTACCACCATTAGATTCTTCAC ATTTTCTTAAACCACTACTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 128} {0: 1, 1: 0, 2: 3, 3: 23, 4: 308}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!