ID: 908206424_908206428

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 908206424 908206428
Species Human (GRCh38) Human (GRCh38)
Location 1:61855037-61855059 1:61855057-61855079
Sequence CCATGGTTTCCATGTCTTTTCTG CTGGATTTGTGTGGTTTTATAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 37, 4: 457} {0: 1, 1: 0, 2: 3, 3: 37, 4: 292}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!