ID: 908247764_908247770

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 908247764 908247770
Species Human (GRCh38) Human (GRCh38)
Location 1:62241563-62241585 1:62241613-62241635
Sequence CCCAGGGCCTGGCATTTGGTCGG AATGCTGCACAAGAACCTAACGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 35, 4: 235} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!