ID: 908260541_908260552

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 908260541 908260552
Species Human (GRCh38) Human (GRCh38)
Location 1:62336776-62336798 1:62336800-62336822
Sequence CCCCTGGGAGCCTGGAGGCCCCT CACCTGGAGGAGCCGGGCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 398} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!