ID: 908260541_908260559

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 908260541 908260559
Species Human (GRCh38) Human (GRCh38)
Location 1:62336776-62336798 1:62336826-62336848
Sequence CCCCTGGGAGCCTGGAGGCCCCT GATGGCTGCCTGCCTGCCGAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!