ID: 908260543_908260549

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 908260543 908260549
Species Human (GRCh38) Human (GRCh38)
Location 1:62336778-62336800 1:62336794-62336816
Sequence CCTGGGAGCCTGGAGGCCCCTAC CCCCTACACCTGGAGGAGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 241} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!