ID: 908260553_908260566

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 908260553 908260566
Species Human (GRCh38) Human (GRCh38)
Location 1:62336802-62336824 1:62336846-62336868
Sequence CCTGGAGGAGCCGGGCCAAGGTT GGGCACTGTAGAGCGGGTGGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!