ID: 908331409_908331423

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 908331409 908331423
Species Human (GRCh38) Human (GRCh38)
Location 1:63074478-63074500 1:63074529-63074551
Sequence CCACACTGCGGCTGCCAGGACCG GGGCCCGCTGATGGAGGCGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 10, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!