ID: 908342047_908342050

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 908342047 908342050
Species Human (GRCh38) Human (GRCh38)
Location 1:63191635-63191657 1:63191657-63191679
Sequence CCCTTGTCCATCTGTTTGGACAG GCAATGTGTCTGCTTGTGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 181} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!