ID: 908360053_908360058

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 908360053 908360058
Species Human (GRCh38) Human (GRCh38)
Location 1:63359993-63360015 1:63360017-63360039
Sequence CCCTCCTCCTTCTGAACCTCAGC CTGCCTCCACTGTGCCAATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 50, 4: 528} {0: 1, 1: 0, 2: 1, 3: 23, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!