ID: 908382109_908382122

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 908382109 908382122
Species Human (GRCh38) Human (GRCh38)
Location 1:63606496-63606518 1:63606544-63606566
Sequence CCGGGATGGCTGCCCACCACCTT CAGGGGAGAAAGATGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 240} {0: 2, 1: 2, 2: 93, 3: 999, 4: 2550}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!