ID: 908382110_908382122

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 908382110 908382122
Species Human (GRCh38) Human (GRCh38)
Location 1:63606508-63606530 1:63606544-63606566
Sequence CCCACCACCTTACCTTCATGCCA CAGGGGAGAAAGATGGAGGAAGG
Strand - +
Off-target summary No data {0: 2, 1: 2, 2: 93, 3: 999, 4: 2550}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!