ID: 908421402_908421406

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 908421402 908421406
Species Human (GRCh38) Human (GRCh38)
Location 1:63962086-63962108 1:63962106-63962128
Sequence CCCATGTCTACTAAAAATACAAA AAAAGTTATCTGGGCATGTTAGG
Strand - +
Off-target summary {0: 1217, 1: 94042, 2: 246506, 3: 151734, 4: 74243} {0: 1, 1: 0, 2: 55, 3: 645, 4: 1816}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!