ID: 908433420_908433429

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 908433420 908433429
Species Human (GRCh38) Human (GRCh38)
Location 1:64081137-64081159 1:64081186-64081208
Sequence CCAACAGAAATAGCCCAAGGCTG TTTCAGGCTGAGCAGTCATAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 158} {0: 1, 1: 0, 2: 1, 3: 15, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!