ID: 908436336_908436339

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 908436336 908436339
Species Human (GRCh38) Human (GRCh38)
Location 1:64110516-64110538 1:64110538-64110560
Sequence CCCATCCTCATCTTTCTTCTGCT TTGCTTCCTGCCTAAAAAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 58, 4: 758} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!