ID: 908438004_908438008

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 908438004 908438008
Species Human (GRCh38) Human (GRCh38)
Location 1:64125741-64125763 1:64125762-64125784
Sequence CCTTTGGGATTGTATTCAAATGA GAGGGCTTGCTAAAGGCTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 175} {0: 1, 1: 0, 2: 3, 3: 18, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!