ID: 908443340_908443347

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 908443340 908443347
Species Human (GRCh38) Human (GRCh38)
Location 1:64177561-64177583 1:64177601-64177623
Sequence CCTTGAAAGACTATAACAACCCC TCAACAAGAAGCCTCCCTAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 115} {0: 1, 1: 0, 2: 0, 3: 5, 4: 88}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
17 1:64177561-64177583 CCTTGAAAGACTATAACAACCCC - 1:64177601-64177623 TCAACAAGAAGCCTCCCTAATGG +