ID: 908445443_908445448

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 908445443 908445448
Species Human (GRCh38) Human (GRCh38)
Location 1:64195570-64195592 1:64195600-64195622
Sequence CCTCTCATGCTTTGAGTCACTGA AAGGGCCTAGTCCCATTTAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 3, 3: 10, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!