ID: 908474169_908474184

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 908474169 908474184
Species Human (GRCh38) Human (GRCh38)
Location 1:64471520-64471542 1:64471549-64471571
Sequence CCCTCCGAGTGGGCTCCGCGCTC CCTCCCGGGAGCATGGGGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 51, 4: 373}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!