ID: 908509833_908509836

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 908509833 908509836
Species Human (GRCh38) Human (GRCh38)
Location 1:64842911-64842933 1:64842924-64842946
Sequence CCACCCTGCACTCTGGACTTCCG TGGACTTCCGCTGCCATTTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 212} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!