ID: 908513896_908513905

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 908513896 908513905
Species Human (GRCh38) Human (GRCh38)
Location 1:64873060-64873082 1:64873099-64873121
Sequence CCCTCTGACCTCTGCACATAAGG AAAATAAAATGGTAGGAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 217} {0: 1, 1: 0, 2: 6, 3: 73, 4: 771}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!