ID: 908534630_908534637

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 908534630 908534637
Species Human (GRCh38) Human (GRCh38)
Location 1:65066689-65066711 1:65066703-65066725
Sequence CCCTCTCTCCGGACCGCCGCCGC CGCCGCCGCCGCGGGGACTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 256} {0: 1, 1: 1, 2: 4, 3: 41, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!