ID: 908534631_908534637

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 908534631 908534637
Species Human (GRCh38) Human (GRCh38)
Location 1:65066690-65066712 1:65066703-65066725
Sequence CCTCTCTCCGGACCGCCGCCGCC CGCCGCCGCCGCGGGGACTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 325} {0: 1, 1: 1, 2: 4, 3: 41, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!