ID: 908550853_908550857

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 908550853 908550857
Species Human (GRCh38) Human (GRCh38)
Location 1:65207327-65207349 1:65207358-65207380
Sequence CCATCTCAGCTTTGGGGTCTTTT CCTATAAGCTTCCTGAGGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 25, 3: 169, 4: 924}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!