ID: 908569922_908569926

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 908569922 908569926
Species Human (GRCh38) Human (GRCh38)
Location 1:65398711-65398733 1:65398744-65398766
Sequence CCATGCAGGCTTCAGGGATGGAA CTGTGTGAACTCAGAAAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 297} {0: 1, 1: 0, 2: 3, 3: 28, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!