ID: 908588123_908588125

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 908588123 908588125
Species Human (GRCh38) Human (GRCh38)
Location 1:65596979-65597001 1:65596996-65597018
Sequence CCAGTTTTAGCAAAGAACTCTGC CTCTGCTAGGTCATTTTAGCAGG
Strand - +
Off-target summary {0: 5, 1: 24, 2: 64, 3: 66, 4: 181} {0: 1, 1: 0, 2: 1, 3: 21, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!