ID: 908670127_908670133

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 908670127 908670133
Species Human (GRCh38) Human (GRCh38)
Location 1:66537069-66537091 1:66537109-66537131
Sequence CCTCCTCAGTGATCCTAATTTTG ATTCCCCAGGGACCACAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 174, 4: 241} {0: 1, 1: 0, 2: 0, 3: 13, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!