ID: 908690737_908690738

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 908690737 908690738
Species Human (GRCh38) Human (GRCh38)
Location 1:66776734-66776756 1:66776768-66776790
Sequence CCATCAAATACAGACATTGTGGT TTTCTATTTTTACAAACCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 182} {0: 1, 1: 0, 2: 0, 3: 35, 4: 312}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!