ID: 908731250_908731254

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 908731250 908731254
Species Human (GRCh38) Human (GRCh38)
Location 1:67228822-67228844 1:67228861-67228883
Sequence CCTTCTCCCTTCTGCTTATAAGA CAGATCCACCCATGTAATCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 62, 4: 406} {0: 1, 1: 0, 2: 2, 3: 13, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!