ID: 908742362_908742368

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 908742362 908742368
Species Human (GRCh38) Human (GRCh38)
Location 1:67342010-67342032 1:67342034-67342056
Sequence CCAGCCTCTAATAGGGATTCCTC TGCCACTCTCAGGCAGGCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 98} {0: 1, 1: 0, 2: 0, 3: 31, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!