ID: 908797159_908797164

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 908797159 908797164
Species Human (GRCh38) Human (GRCh38)
Location 1:67841974-67841996 1:67841990-67842012
Sequence CCTGGCTCCAACTCTACCTGCAG CCTGCAGCAGGACTACCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 329} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!